version
PlantPromoterDB promoter information of AT1G01490

Summary of Gene (AT1G01490)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G01490  TAIR      NCBI 
Gene model AT1G01490  
Description heavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT5G23760.1); Has 7628 Blast hits to 3670 proteins in 294 species: Archae - 47; Bacteria - 686; Metazoa - 2844; Fungi - 342; Plants - 780; Viruses - 96; Other Eukaryotes - 2833 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 185966-184767)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G01490                        5'->3' (-)
Promoter sequence

 
AT1G01500.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G01490

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-182212-146

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-182367-301
TSS cloneTclone-182357-291
TSS cloneTclone-182348-282
TSS cloneGclone-182327-261
TSS cloneGclone-182325-259
TSS cloneTclone-182302-236
TSS cloneAclone-182241-175
TSS cloneAclone-182089-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTTCTT-182173182186-107-120
Y PatchTCTCTCTT-182216182223-150-157
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCACGCGC-182418182425-352-359
 AtREG395TCACGCGC PPDB MotifACGCGC  PLACE Motif 
REGCACGCGCC-182431182438-365-372
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+185108AT1G01500.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+185137AT1G01500.1
TSS cloneTclone+185154AT1G01500.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAGCCCATTTAACGG+184883184898AT1G01500.1
 AtREG426TAAGCCCA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386   GCCCATTT      PPDB MotifGCCCA  PLACE Motif 
 AtREG443    CCCATTTA     PPDB MotifGCCCA  PLACE Motif 
 AtREG610        TTTAACGG PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGATGGCCCAGT+184913184922AT1G01500.1
 AtREG437ATGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 TGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384  GGCCCAGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAAAAAGCC+184948184955AT1G01500.1
 AtREG589AAAAAGCC PPDB Motif  PLACE Motif 
REGTCACACGTGCG+184967184977AT1G01500.1
 AtREG588TCACACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG460 CACACGTG  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG541   CACGTGCG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGAGGGTATTT+184994185002AT1G01500.1
 AtREG567AGGGTATT  PPDB MotifACCCT  PLACE Motif 
 AtREG602 GGGTATTT PPDB Motif  PLACE Motif 
REGTTTGACCC+185024185031AT1G01500.1
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGCGTAATTA+185035185042AT1G01500.1
 AtREG646CGTAATTAABA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.