version
PlantPromoterDB promoter information of AT1G02405.1

Summary of Gene (AT1G02405.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G02405  TAIR      NCBI 
Gene model AT1G02405.1  
Description proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 491497-490298)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G02405.1                      5'->3' (-)
Promoter sequence











 
AT1G02410.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G02405.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-490504-7

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATATACAC-490526490536-29-39
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAATAAAGCCCAAAT-490749490769-252-272
 AtREG484TTGGCCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TGGCCCAA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352  GGCCCAAT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355   GCCCAATA           PPDB MotifGCCCA  PLACE Motif 
 AtREG417    CCCAATAA          PPDB MotifGCCCA  PLACE Motif 
 AtREG601        ATAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365         TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376          AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469            AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421             GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATAT-490773490783-276-286
 AtREG426TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432   GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+490875AT1G02410.1
TSS clone peakTclone+490928AT1G02410.1
TSS cloneTclone+490944AT1G02410.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCC+490965490972AT1G02410.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATTTGGGCTTTATTGGGCCAA+490749490769AT1G02410.1
 AtREG421ATTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA          PPDB MotifGCCCA  PLACE Motif 
 AtREG601     GGCTTTAT         PPDB Motif  PLACE Motif 
 AtREG417         TTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG355          TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352           ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420            TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484             TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATATGGGCTTA+490773490783AT1G02410.1
 AtREG432ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAACCGACT+490831490838AT1G02410.1
 AtREG641AACCGACT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGTTGACTTT+490885490892AT1G02410.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.