version
PlantPromoterDB promoter information of AT1G02780

Summary of Gene (AT1G02780)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G02780  TAIR      NCBI 
Gene model AT1G02780  
Description embryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 610391-609192)

Genome position     
from initiation codon
AT1G02780.1         
AT1G02790.1         
TSS from cDNA
TSS information
AT1G02780                        5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G02780

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA251-609434-43

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-609434-43
TSS cloneGclone-609433-42
TSS cloneCclone-609430-39
TSS cloneTclone-609429-38
TSS cloneCclone-609427-36
TSS cloneCclone-609425-34
TSS cloneCclone-609424-33
TSS cloneCclone-609422-31
TSS cloneAclone-609418-27

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATAAATT-609457609467-66-76
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCTAGA-609477609484-86-93
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 
REGTTAAAGCCCAATAT-609504609517-113-126
 AtREG545TTAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509      CCCAATAT PPDB Motif  PLACE Motif 
REGAAAAGCCCATTT-609523609534-132-143
 AtREG409AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386    GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTAATTGGG-609540609547-149-156
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.