version
PlantPromoterDB promoter information of AT1G03050.1

Summary of Gene (AT1G03050.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G03050  TAIR      NCBI 
Gene model AT1G03050.1  
Description epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: N-terminal protein myristoylation, clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT4G02650.1); Has 1593 Blast hits to 1129 proteins in 163 species: Archae - 4; Bacteria - 34; Metazoa - 881; Fungi - 155; Plants - 233; Viruses - 12; Other Eukaryotes - 274 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 706726-707925)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G03050.1                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G03050.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATAAAGCCCACT-706756706767AT1G03040.1
 AtREG601ATAAAGCC     PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518   AAGCCCAC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510    AGCCCACT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAAAGCCCACT-706777706788AT1G03040.1
 AtREG589AAAAAGCC     PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518   AAGCCCAC  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510    AGCCCACT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAGTCAA-706792706799AT1G03040.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.