version
PlantPromoterDB promoter information of AT1G03140.1

Summary of Gene (AT1G03140.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G03140  TAIR      NCBI 
Gene model AT1G03140.1  
Description splicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 757223-756024)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G03140.1                      5'->3' (-)
Promoter sequence











 
AT1G03150.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G03140.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-756265-42

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-756285-62
TSS cloneTclone-756282-59
TSS cloneTclone-756271-48

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGATGACGT-756320756327-97-104
 AtREG578GATGACGTABA PPDB MotifACGT  PLACE MotifACGT 
REGATTTGGGCCTATA-756333756345-110-122
 AtREG421ATTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362    GGGCCTAT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG487     GGCCTATA PPDB Motif  PLACE Motif 
REGATAAAGCCCATTTA-756347756360-124-137
 AtREG601ATAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386     GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443      CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCAGT-756371756380-148-157
 AtREG437ATGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 TGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384  GGCCCAGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+756418AT1G03150.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+756414AT1G03150.1
TSS cloneTclone+756426AT1G03150.1
TSS cloneGclone+756427AT1G03150.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTTTCT+756400756411AT1G03150.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGTCATC+756320756327AT1G03150.1
 AtREG578ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGTATAGGCCCAAAT+756333756345AT1G03150.1
 AtREG487TATAGGCC      PPDB Motif  PLACE Motif 
 AtREG362 ATAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373    GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421     GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGGCTTTAT+756347756360AT1G03150.1
 AtREG443TAAATGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365     GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601      GGCTTTAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.