version
PlantPromoterDB promoter information of AT1G03470

Summary of Gene (AT1G03470)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G03470  TAIR      NCBI 
Gene model AT1G03470  
Description kinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 868493-867294)

Genome position     
from initiation codon
AT1G03470.1         
AT1G03470.2         
TSS from cDNA
TSS information
AT1G03470                        5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G03470

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-867745-252
TSS peakA2-867734-241

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACGTGGCAAT-867809867819-316-326
 AtREG413TACGTGGC    PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452  CGTGGCAA  PPDB Motif  PLACE MotifGCCAC 
 AtREG654   GTGGCAAT PPDB Motif  PLACE MotifGCCAC 
REGCGTCATTT-867919867926-426-433
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 
REGTAAGGGGT-867932867939-439-446
 AtREG636TAAGGGGT PPDB MotifACCCCT  PLACE Motif 
REGTTGACTTT-868028868035-535-542
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.