version
PlantPromoterDB promoter information of AT1G04620

Summary of Gene (AT1G04620)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G04620  TAIR      NCBI 
Gene model AT1G04620  
Description coenzyme F420 hydrogenase family / dehydrogenase, beta subunit family; FUNCTIONS IN: coenzyme F420 hydrogenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Coenzyme F420 hydrogenase/dehydrogenase beta subunit, C-terminal (InterPro:IPR007525), Coenzyme F420 hydrogenase/dehydrogenase beta subunit, N-terminal (InterPro:IPR007516); Has 371 Blast hits to 370 proteins in 121 species: Archae - 138; Bacteria - 142; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 1291142-1289943)

Genome position     
from initiation codon
AT1G04630.1         
TSS from cDNA
TSS information
AT1G04620                        5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G04620

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-1286584-92
TSS clone peakAclone-1286560-68
TSS cloneTclone-1286559-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG23-1291075AT1G04630.1
TSS peakG5-1289945AT1G04625.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-1291078AT1G04630.1
TSS cloneTclone-1291077AT1G04630.1
TSS cloneGclone-1291074AT1G04630.1
TSS cloneAclone-1291048AT1G04630.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTAATGGGCTTAG-12911261291138AT1G04630.1
 AtREG558CTAATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426    TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634     GGGCTTAG PPDB MotifGCCCA  PLACE Motif 
REGCTAAGCCCATTAG+12911261291138AT1G04635.1
 AtREG634CTAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357    GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558     CCCATTAG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.