version
PlantPromoterDB promoter information of AT1G04950.2

Summary of Gene (AT1G04950.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G04950  TAIR      NCBI 
Gene model AT1G04950.2  
Description Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.  
#
#

Overview

Focused view (chromosome 1: 1408184-1406985)

Genome position     
from initiation codon
AT1G04950.1         
AT1G04950.3         
AT1G04960.1         
AT1G04960.2         
TSS from cDNA
TSS information
AT1G04950.2                      5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G04950.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC2-1408166-982
TSS peakA5-1407480-296

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-1407496-312
TSS cloneAclone-1407479-295
TSS cloneTclone-1407468-284
TSS cloneGclone-1407459-275

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCTCTCC-14074361407444-252-260
Y PatchTCTTTCCTCTC-14074811407491-297-307
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGGCCC-14075371407544-353-360
 AtREG404CCCGGCCCCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAACCGGGT-14075671407574-383-390
 AtREG455AACCGGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAGCCCAAAT-14075971407605-413-421
 AtREG469AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421 GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCTTATTGGGCCTTGGCCCAAAA-14076191407640-435-456
 AtREG611CTTATTGG               PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG              PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC             PPDB MotifGCCCA  PLACE Motif 
 AtREG352   ATTGGGCC            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356    TTGGGCCT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353     TGGGCCTT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG398      GGGCCTTG         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG484           TTGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420            TGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373             GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529              GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.