version
PlantPromoterDB promoter information of AT1G05850.1

Summary of Gene (AT1G05850.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G05850  TAIR      NCBI 
Gene model AT1G05850.1  
Description Encodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants.  
#
#

Overview

Focused view (chromosome 1: 1769117-1767918)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G05850.1                      5'->3' (-)
Promoter sequence













 
AT1G05860.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G05850.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA300-1768663-546

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-1768695-578
TSS cloneGclone-1768690-573
TSS cloneCclone-1768665-548
TSS cloneAclone-1768663-546
TSS cloneAclone-1768662-545
TSS cloneAclone-1768659-542
TSS cloneTclone-1768656-539
TSS cloneTclone-1768654-537
TSS cloneCclone-1768652-535
TSS cloneAclone-1768648-531
TSS cloneTclone-1768647-530
TSS cloneGclone-1768639-522
TSS cloneAclone-1768637-520
TSS cloneTclone-1768612-495
TSS cloneTclone-1768574-457
TSS cloneTclone-1768562-445
TSS cloneTclone-1768137-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCCT-17686501768658-533-541
Y PatchTTTCTTCTTCCTCCTCTCTTTC-17686661768687-549-570
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCAACGG-17687291768737-612-620
 AtREG586ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 AtREG554 TCCAACGG PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGTAGGGCCCACA-17688131768823-696-706
 AtREG387TAGGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG400 AGGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG612   GGCCCACADREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTAAAAGCCCAATGGGCCATA-17689261768945-809-828
 AtREG549TAAAAGCC             PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC            PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461     GCCCAATG        PPDB MotifGCCCA  PLACE Motif 
 AtREG551        CAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361         AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490          ATGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437           TGGGCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479            GGGCCATA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGGGCCTTAC-17689471768954-830-837
 AtREG530GGCCTTAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTTTCTCTCTCCC+17690251769041AT1G05860.1
Y PatchCCTTCTTCTTCC+17690851769096AT1G05860.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGTGGGCCCTA+17688131768823AT1G05860.1
 AtREG612TGTGGGCC   DREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG400  TGGGCCCT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG387   GGGCCCTA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTATGGCCCATTGGGCTTTTA+17689261768945AT1G05860.1
 AtREG479TATGGCCC             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437 ATGGCCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  TGGCCCAT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG551    GCCCATTG         PPDB MotifGCCCA  PLACE Motif 
 AtREG461       CATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402        ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407         TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376          TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409           GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549            GGCTTTTA PPDB Motif  PLACE Motif 
REGGTAAGGCC+17689471768954AT1G05860.1
 AtREG530GTAAGGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.