version
PlantPromoterDB promoter information of AT1G06670.1

Summary of Gene (AT1G06670.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G06670  TAIR      NCBI 
Gene model AT1G06670.1  
Description nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins  
#
#

Overview

Focused view (chromosome 1: 2039567-2040766)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G06670.1                      5'->3' (+)
Promoter sequence













 
AT1G06660.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G06670.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+2040457-110

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTC+20404902040497-77-70
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGCCCAAAAGGCCCAAAAAGCCCAAAA+20403402040367-227-200
 AtREG420TGGCCCAA                     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373 GGCCCAAA GGCCCAAA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529  GCCCAAAA GCCCAAAA GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
 AtREG459      AAAAGGCC               PPDB Motif  PLACE Motif 
 AtREG359       AAAGGCCC              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353        AAGGCCCA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356         AGGCCCAA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG589               AAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409                AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376                 AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407                  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469                   AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.