version
PlantPromoterDB promoter information of AT1G06690.1

Summary of Gene (AT1G06690.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G06690  TAIR      NCBI 
Gene model AT1G06690.1  
Description aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 2053039-2051840)

Genome position     
from initiation codon
AT1G06700.1         
AT1G06700.2         
TSS from cDNA
TSS information
AT1G06690.1                      5'->3' (-)
Promoter sequence


















 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G06690.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-2052807-768
TSS peakA5-2052066-27

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTCCTCCT-20520722052085-33-46
Y PatchCCTCTTCTTCTTCTTCTTCTTCTT-20520882052111-49-72
Y PatchCCTCTCCT-20527872052794-748-755
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAAAC-20521112052118-72-79
 AtREG474GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTACGTGTCC-20521472052155-108-116
 AtREG557TACGTGTC ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG472 ACGTGTCCABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGACCGGTTAT-20521882052196-149-157
 AtREG503ACCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG548 CCGGTTAT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCAAAGGCCCAACCAAGCCCAA-20522392052259-200-220
 AtREG656CAAAGGCC              PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449    GGCCCAAC          PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG525            CAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407             AAGCCCAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAAGGCCCAACT-20522742052286-235-247
 AtREG459AAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449    GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG607     GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTAAAAGCC-20530132053020-974-981
 AtREG549TAAAAGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.