version
PlantPromoterDB promoter information of AT1G06730.1

Summary of Gene (AT1G06730.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G06730  TAIR      NCBI 
Gene model AT1G06730.1  
Description pfkB-type carbohydrate kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: D-ribose catabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611); BEST Arabidopsis thaliana protein match is: pfkB-type carbohydrate kinase family protein (TAIR:AT3G59480.1); Has 8525 Blast hits to 8520 proteins in 1199 species: Archae - 160; Bacteria - 6264; Metazoa - 85; Fungi - 26; Plants - 192; Viruses - 0; Other Eukaryotes - 1798 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 2066633-2067832)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G06730.1                      5'->3' (+)
Promoter sequence









 
AT1G06720.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G06730.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2067529-104
TSS clone peakAclone+2067535-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTCTTCTTCCTC+20674852067501-148-132
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGTTTAA+20673982067405-235-228
 AtREG473CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCCGGTTCGGT+20674182067430-215-203
 AtREG516AACCCGGT      PPDB Motif  PLACE Motif 
 AtREG455 ACCCGGTT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423   CCGGTTCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456    CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451     GGTTCGGT PPDB Motif  PLACE Motif 
REGTCCGGTTTAG+20674542067463-179-170
 AtREG521TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511  CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.