version
PlantPromoterDB promoter information of AT1G07110.1

Summary of Gene (AT1G07110.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G07110  TAIR      NCBI 
Gene model AT1G07110.1  
Description Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase.  
#
#

Overview

Focused view (chromosome 1: 2184980-2183781)

Genome position     
from initiation codon
AT1G07119.1         
AT1G07120.1         
TSS from cDNA
TSS information
AT1G07110.1                      5'->3' (-)
Promoter sequence






 
AT1G07119           
AT1G07119.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G07110.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-2184025-45

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-2184121-141
TSS cloneTclone-2184097-117
TSS cloneTclone-2184075-95

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTTCTT-21840382184049-58-69
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAACCGGAA-21841412184150-161-170
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534  AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATCCGGTTAT-21841692184178-189-198
 AtREG561ATCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621 TCCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG548  CCGGTTAT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCAAGCCCAGCCCAAAA-21842212184236-241-256
 AtREG525CAAGCCCA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG454   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG469       AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529        GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGATAGGCCCAATAA-21842442184256-264-276
 AtREG362ATAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417     CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.