version
PlantPromoterDB promoter information of AT1G08500

Summary of Gene (AT1G08500)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G08500  TAIR      NCBI 
Gene model AT1G08500  
Description plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); Has 338 Blast hits to 336 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 338; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 2688110-2689309)

Genome position     
from initiation codon
AT1G08500.1         
TSS from cDNA
TSS information
AT1G08500                        5'->3' (+)
Promoter sequence

 
AT1G08490.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G08500

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2689016-94
TSS clone peakAclone+2689068-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-2688589AT1G08490.1
TSS peakG8-2688581AT1G08490.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-2688589AT1G08490.1
TSS cloneAclone-2688586AT1G08490.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTCC-26885512688560AT1G08490.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAAGGCCTAATTCGGCCCATAT-26886352688657AT1G08490.1
 AtREG459AAAAGGCC                PPDB Motif  PLACE Motif 
 AtREG506    GGCCTAAT            PPDB Motif  PLACE Motif 
 AtREG427           TTCGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393            TCGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380             CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364              GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432               GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGAGGGCCCATTTA-26886652688676AT1G08490.1
 AtREG400AGGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391 GGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361  GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG386   GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443    CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGTTTAACCGGTTTG-26886952688707AT1G08490.1
 AtREG645TTTAACCG      PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 TTAACCGG     PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503  TAACCGGT    PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG436    ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496     CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAGTCGGTTGAACCGGT-26887092688724AT1G08490.1
 AtREG641AGTCGGTT         PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
 AtREG640      TTGAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480       TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528        GAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.