version
PlantPromoterDB promoter information of AT1G10950.1

Summary of Gene (AT1G10950.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G10950  TAIR      NCBI 
Gene model AT1G10950.1  
Description endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 3663522-3664721)

Genome position     
from initiation codon
AT1G10960.1         
TSS from cDNA
TSS information
AT1G10950.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G10950.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+3659247-75

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+3659209-113
TSS cloneTclone+3659211-111
TSS cloneAclone+3659217-105
TSS cloneAclone+3659239-83
TSS cloneTclone+3659241-81
TSS cloneAclone+3659243-79
TSS cloneTclone+3659260-62
TSS cloneTclone+3659264-58
TSS cloneGclone+3659266-56
TSS cloneAclone+3659267-55
TSS cloneGclone+3659270-52
TSS cloneTclone+3659274-48

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTC+36592573659265-65-57
Y PatchCCTTCCTC+36592873659294-35-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATATGGGCCG+36590353659045-287-277
 AtREG620TATATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG364  TATGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380   ATGGGCCG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAAAGGCCCAAT+36590733659083-249-239
 AtREG359AAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTATATGGG+36591133659120-209-202
 AtREG620TATATGGG PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCAATTA+36591523659163-170-159
 AtREG525CAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418   GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600    CCCAATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA61+3664389AT1G10960.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+3664386AT1G10960.1
TSS cloneAclone+3664387AT1G10960.1
TSS cloneTclone+3664390AT1G10960.1
TSS cloneAclone+3664395AT1G10960.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTTTATAA+36643533664361AT1G10960.1
Y PatchTCCTCTCTCCC+36643623664372AT1G10960.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTGGGACC+36640963664103AT1G10960.1
 AtREG406GTGGGACC PPDB MotifGGGACCC  PLACE Motif 
REGACGCCACGTGGCAG+36643323664345AT1G10960.1
 AtREG508ACGCCACG       PPDB Motif  PLACE MotifGCCAC 
 AtREG371 CGCCACGT     ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379     ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG468      CGTGGCAGABA PPDB Motif  PLACE MotifGCCAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.