version
PlantPromoterDB promoter information of AT1G12000.1

Summary of Gene (AT1G12000.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G12000  TAIR      NCBI 
Gene model AT1G12000.1  
Description pyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex, cell wall, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: MEE51 (maternal effect embryo arrest 51); diphosphate-fructose-6-phosphate 1-phosphotransferase (TAIR:AT4G04040.1); Has 3585 Blast hits to 3515 proteins in 1006 species: Archae - 20; Bacteria - 2321; Metazoa - 52; Fungi - 90; Plants - 237; Viruses - 2; Other Eukaryotes - 863 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4054727-4053528)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G12000.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G12000.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG46-4053835-108

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-4053835-108
TSS cloneAclone-4053834-107
TSS cloneAclone-4053833-106
TSS cloneAclone-4053829-102

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGTATATATTC-40538614053871-134-144
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATACCCTT-40539284053937-201-210
 AtREG602AAATACCC   PPDB Motif  PLACE Motif 
 AtREG567 AATACCCT  PPDB MotifACCCT  PLACE Motif 
 AtREG623  ATACCCTT PPDB MotifACCCT  PLACE Motif 
REGAATTGGGCCTTAA-40539824053994-255-267
 AtREG418AATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416     GGCCTTAA PPDB Motif  PLACE Motif 
REGAAAAGCCCAAAA-40539994054010-272-283
 AtREG409AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469   AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.