version
PlantPromoterDB promoter information of AT1G12640.1

Summary of Gene (AT1G12640.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G12640  TAIR      NCBI 
Gene model AT1G12640.1  
Description membrane bound O-acyl transferase (MBOAT) family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane bound O-acyl transferase, MBOAT (InterPro:IPR004299); BEST Arabidopsis thaliana protein match is: membrane bound O-acyl transferase (MBOAT) family protein (TAIR:AT1G63050.1); Has 864 Blast hits to 862 proteins in 168 species: Archae - 0; Bacteria - 109; Metazoa - 536; Fungi - 94; Plants - 27; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4306666-4305467)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G12640.1                      5'->3' (-)
Promoter sequence




 
AT1G12650.1         
AT1G12650.2         
AT1G12650.3         
AT1G12650.4         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G12640.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG21-4305723-57

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-4305791-125
TSS cloneAclone-4305790-124
TSS cloneTclone-4305754-88
TSS cloneAclone-4305717-51

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGACACGACACG-43057644305776-98-110
 AtREG428ACGACACGACACGABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGACGACACGACACC-43057864305798-120-132
 AtREG428ACGACACG     ABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
 AtREG599     ACGACACC PPDB Motif  PLACE Motif 
REGGACCGGTTTAT-43058394305849-173-183
 AtREG552GACCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 ACCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598   CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGT-43058884305896-222-230
 AtREG473TTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652 TAAACCGT PPDB Motif  PLACE Motif 
REGAGGGTATTT-43059004305908-234-242
 AtREG567AGGGTATT  PPDB MotifACCCT  PLACE Motif 
 AtREG602 GGGTATTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8+4305933AT1G12650.1, AT1G12650.2, AT1G12650.3, AT1G12650.4

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+4306059AT1G12650.1, AT1G12650.2, AT1G12650.3, AT1G12650.4

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGTGTCGTGTCGT+43057644305776AT1G12650.1, AT1G12650.2, AT1G12650.3, AT1G12650.4
 AtREG428CGTGTCGTGTCGTABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGGGTGTCGTGTCGT+43057864305798AT1G12650.1, AT1G12650.2, AT1G12650.3, AT1G12650.4
 AtREG599GGTGTCGT      PPDB Motif  PLACE Motif 
 AtREG428     CGTGTCGTABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGATAAACCGGTC+43058394305849AT1G12650.1, AT1G12650.2, AT1G12650.3, AT1G12650.4
 AtREG598ATAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552   AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.