version
PlantPromoterDB promoter information of AT1G12830.1

Summary of Gene (AT1G12830.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G12830  TAIR      NCBI 
Gene model AT1G12830.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4376053-4374854)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G12830.1                      5'->3' (-)
Promoter sequence









 
AT1G12840.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G12830.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-4375169-116

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGGCTAATACTGGGCCAA-43752284375250-175-197
 AtREG443TAAATGGG                PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC               PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571    TGGGCTAA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG434            TACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG384             ACTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458              CTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484               TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGTCCGGTTTT-43753334375342-280-289
 AtREG573GTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542  CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATTGCCAC-43753694375376-316-323
 AtREG654ATTGCCAC PPDB Motif  PLACE MotifGCCAC 
REGCCGGTTTAA-43754334375441-380-388
 AtREG412CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473 CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGGT-43754594375467-406-414
 AtREG496CAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA46+4375515AT1G12840.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+4375516AT1G12840.1
TSS cloneGclone+4375517AT1G12840.1
TSS cloneCclone+4375518AT1G12840.1
TSS cloneAclone+4375519AT1G12840.1
TSS cloneGclone+4375572AT1G12840.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxGTATATAAT+43754834375491AT1G12840.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGGCCCAGTATTAGCCCATTTA+43752284375250AT1G12840.1
 AtREG484TTGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 TGGCCCAG               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384  GGCCCAGT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG434   GCCCAGTA             PPDB MotifGCCCA  PLACE Motif 
 AtREG571           TTAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581            TAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372             AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386              GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443               CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGAAAACCGGAC+43753334375342AT1G12840.1
 AtREG542AAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573  AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTGGCAAT+43753694375376AT1G12840.1
 AtREG654GTGGCAAT PPDB Motif  PLACE MotifGCCAC 
REGTTAAACCGG+43754334375441AT1G12840.1
 AtREG473TTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGTTTG+43754594375467AT1G12840.1
 AtREG436ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.