version
PlantPromoterDB promoter information of AT1G12900.1

Summary of Gene (AT1G12900.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G12900  TAIR      NCBI 
Gene model AT1G12900.1  
Description GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4392283-4391084)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G12900.1                      5'->3' (-)
Promoter sequence

 
AT1G12880.1         
AT1G12890.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G12900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA100-4394311-28

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-4394400-117
TSS cloneCclone-4394372-89
TSS cloneTclone-4394343-60
TSS cloneCclone-4394315-32
TSS cloneTclone-4394313-30
TSS cloneAclone-4394311-28
TSS cloneTclone-4394310-27
TSS cloneCclone-4394308-25
TSS cloneAclone-4394303-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTCCTATAT-43943414394349-58-66
Y PatchCTTTCTCT-439426343942702013
Y PatchCTTCTCTCTCT-43942914394301-8-18
Y PatchCCTCTTCT-43943214394328-38-45
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCAA-43944844394492-201-209
 AtREG476GAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAAGCCCAT-43945014394509-218-226
 AtREG476GAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.