version
PlantPromoterDB promoter information of AT1G12900.1

Summary of Gene (AT1G12900.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G12900  TAIR      NCBI 
Gene model AT1G12900.1  
Description GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4398683-4397484)

Genome position     
from initiation codon
AT1G12920.1         
AT1G12930.1         
TSS from cDNA
TSS information
AT1G12900.1                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G12900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA100-4394311-28

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-4394400-117
TSS cloneCclone-4394372-89
TSS cloneTclone-4394343-60
TSS cloneCclone-4394315-32
TSS cloneTclone-4394313-30
TSS cloneAclone-4394311-28
TSS cloneTclone-4394310-27
TSS cloneCclone-4394308-25
TSS cloneAclone-4394303-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTCCTATAT-43943414394349-58-66
Y PatchCTTTCTCT-439426343942702013
Y PatchCTTCTCTCTCT-43942914394301-8-18
Y PatchCCTCTTCT-43943214394328-38-45
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCAA-43944844394492-201-209
 AtREG476GAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAAGCCCAT-43945014394509-218-226
 AtREG476GAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-4398143AT1G12920.1
TSS peakG2-4397912AT1G12920.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-4398170AT1G12920.1
TSS cloneTclone-4398145AT1G12920.1
TSS cloneGclone-4398137AT1G12920.1
TSS cloneAclone-4397868AT1G12920.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTCTC-43978874397896AT1G12920.1
Y PatchTTCTTCTT-43979244397931AT1G12920.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGCCACGTG-43982054398214AT1G12920.1
 AtREG452TTGCCACG   PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTGABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
REGATAAAGCCCATTAG-43982324398245AT1G12920.1
 AtREG601ATAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357     GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558      CCCATTAG PPDB MotifGCCCA  PLACE Motif 
REGTAATTGGGCCTTTT-43982544398267AT1G12920.1
 AtREG600TAATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353    TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359     GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459      GGCCTTTT PPDB Motif  PLACE Motif 
REGTAAACGGCACG-43983204398330AT1G12920.1
 AtREG613TAAACGGC    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG522   ACGGCACG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.