version
PlantPromoterDB promoter information of AT1G13030.1

Summary of Gene (AT1G13030.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G13030  TAIR      NCBI 
Gene model AT1G13030.1  
Description sphere organelles protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; Has 13894 Blast hits to 8686 proteins in 584 species: Archae - 12; Bacteria - 813; Metazoa - 5398; Fungi - 1230; Plants - 486; Viruses - 98; Other Eukaryotes - 5857 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4448278-4447079)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G13030.1                      5'->3' (-)
Promoter sequence












 
AT1G13040.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G13030.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4447406-128
TSS clone peakGclone-4447405-127

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTTCTTCTCC-44473744447389-96-111
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATGGGCTTAAATGGGCTTTAAATAAGGCCCAAT-44474504447484-172-206
 AtREG432ATATGGGC                            PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT                           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  ATGGGCTT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA                         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG443         TAAATGGG                   PPDB MotifGCCCA  PLACE Motif 
 AtREG386          AAATGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG372           AATGGGCT                 PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376             TGGGCTTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365              GGGCTTTA              PPDB MotifGCCCA  PLACE Motif 
 AtREG545               GGCTTTAA             PPDB Motif  PLACE Motif 
 AtREG425                       ATAAGGCC     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351                        TAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353                         AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356                          AGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352                           GGCCCAAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.