version
PlantPromoterDB promoter information of AT1G13370

Summary of Gene (AT1G13370)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G13370  TAIR      NCBI 
Gene model AT1G13370  
Description histone H3, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: flower, inflorescence, root, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10206 Blast hits to 10203 proteins in 5279 species: Archae - 0; Bacteria - 0; Metazoa - 7337; Fungi - 1299; Plants - 998; Viruses - 0; Other Eukaryotes - 572 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4591372-4590173)

Genome position     
from initiation codon
AT1G13380.1         
TSS from cDNA
TSS information
AT1G13370                        5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G13370

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-4589433-911
TSS peakA2-4588613-91

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCACTATAAAAT-45886394588649-117-127
Y PatchTTTCTCTCT-45885714588579-49-57
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCTTTAA-45887074588714-185-192
 AtREG639GCCTTTAA PPDB MotifAAACG(C/G)  PLACE Motif 
REGCCAATAAG-45887814588788-259-266
 AtREG611CCAATAAG PPDB Motif  PLACE Motif 
REGATAAAGCC-45888854588892-363-370
 AtREG601ATAAAGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-4590410AT1G13380.1
TSS clone peakTclone-4590399AT1G13380.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC-45903734590380AT1G13380.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACGACAC-45904684590475AT1G13380.1
 AtREG527AACGACACDREB1Aox PPDB Motif  PLACE Motif 
REGCACGCGCT-45904994590506AT1G13380.1
 AtREG381CACGCGCT PPDB MotifACGCGC  PLACE Motif 
REGACGTGACA-45905094590516AT1G13380.1
 AtREG606ACGTGACAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCCGCGTGAA-45905414590549AT1G13380.1
 AtREG502CCGCGTGA Drought PPDB Motif  PLACE Motif 
 AtREG631 CGCGTGAADrought PPDB Motif  PLACE Motif 
REGCACGCGCC-45905574590564AT1G13380.1
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGGGCCTTTA-45906254590632AT1G13380.1
 AtREG467GGCCTTTA PPDB Motif  PLACE Motif 
REGTTAGCCCATCAAGCCCATAT-45906444590663AT1G13380.1
 AtREG571TTAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581 TAGCCCAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635   GCCCATCA          PPDB MotifGCCCA  PLACE Motif 
 AtREG525         CAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378          AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477           AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432            GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTC-45906654590674AT1G13380.1
 AtREG421ATTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.