version
PlantPromoterDB promoter information of AT1G13380.1

Summary of Gene (AT1G13380.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G13380  TAIR      NCBI 
Gene model AT1G13380.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27435.1); Has 150 Blast hits to 150 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4591362-4590163)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G13380.1                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G13380.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-4590410-48
TSS clone peakTclone-4590399-37

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC-45903734590380-11-18
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGACAC-45904684590475-106-113
 AtREG527AACGACACDREB1Aox PPDB Motif  PLACE Motif 
REGCACGCGCT-45904994590506-137-144
 AtREG381CACGCGCT PPDB MotifACGCGC  PLACE Motif 
REGACGTGACA-45905094590516-147-154
 AtREG606ACGTGACAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCCGCGTGAA-45905414590549-179-187
 AtREG502CCGCGTGA Drought PPDB Motif  PLACE Motif 
 AtREG631 CGCGTGAADrought PPDB Motif  PLACE Motif 
REGCACGCGCC-45905574590564-195-202
 AtREG486CACGCGCC PPDB MotifACGCGC  PLACE Motif 
REGGGCCTTTA-45906254590632-263-270
 AtREG467GGCCTTTA PPDB Motif  PLACE Motif 
REGTTAGCCCATCAAGCCCATAT-45906444590663-282-301
 AtREG571TTAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581 TAGCCCAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635   GCCCATCA          PPDB MotifGCCCA  PLACE Motif 
 AtREG525         CAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378          AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477           AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432            GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTC-45906654590674-303-312
 AtREG421ATTTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533  TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.