version
PlantPromoterDB promoter information of AT1G14230.1

Summary of Gene (AT1G14230.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G14230  TAIR      NCBI 
Gene model AT1G14230.1  
Description nucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 4860497-4861696)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G14230.1                      5'->3' (+)
Promoter sequence







 
AT1G14225.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G14230.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+4861274-223

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+4861258-239
TSS cloneAclone+4861271-226

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTCC+48612614861270-236-227
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTAAACCGGTCCGGTTCA+48610844861101-413-396
 AtREG519GTAAACCG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552   AACCGGTC        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573        GTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579         TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480          CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGGA+48611244861132-373-365
 AtREG542AAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGACCCGAA+48611824861190-315-307
 AtREG617TGACCCGA  PPDB Motif  PLACE Motif 
 AtREG597 GACCCGAA PPDB MotifGGGACCC  PLACE Motif 
REGAACCCGACCCGGT+48611994861211-298-286
 AtREG580AACCCGAC      PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405 ACCCGACC     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442  CCCGACCC    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375   CCGACCCG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG494    CGACCCGG  PPDB Motif  PLACE Motif 
 AtREG463     GACCCGGT PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.