version
PlantPromoterDB promoter information of AT1G15060.1

Summary of Gene (AT1G15060.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G15060  TAIR      NCBI 
Gene model AT1G15060.1  
Description LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase, At1g15070 (InterPro:IPR016969); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73750.1); Has 120 Blast hits to 104 proteins in 29 species: Archae - 0; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 5187856-5186657)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G15060.1                      5'->3' (-)
Promoter sequence





 
AT1G15080.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G15060.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-5186971-115

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-5186933-77

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTC-51869525186959-96-103
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGCCCAAAA-51870155187024-159-168
 AtREG420TGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373 GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529  GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCTTTT-51870355187046-179-190
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGCAAAGGCC-51870785187085-222-229
 AtREG656CAAAGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone+5187626AT1G15080.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCCT+51876585187665AT1G15080.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.