version
PlantPromoterDB promoter information of AT1G15830.1

Summary of Gene (AT1G15830.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G15830  TAIR      NCBI 
Gene model AT1G15830.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: pollen tube; Has 147578 Blast hits to 47511 proteins in 1815 species: Archae - 216; Bacteria - 33133; Metazoa - 53776; Fungi - 10273; Plants - 15545; Viruses - 2335; Other Eukaryotes - 32300 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 5447726-5448925)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G15830.1                      5'->3' (+)
Promoter sequence

 
AT1G15820.1         
AT1G15825.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G15830.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC125-5447763AT1G15820.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-5447791AT1G15820.1
TSS cloneCclone-5447788AT1G15820.1
TSS cloneTclone-5447782AT1G15820.1
TSS cloneAclone-5447776AT1G15820.1
TSS cloneTclone-5447772AT1G15820.1
TSS cloneTclone-5447765AT1G15820.1
TSS cloneCclone-5447764AT1G15820.1
TSS cloneCclone-5447763AT1G15820.1
TSS cloneGclone-5447762AT1G15820.1
TSS cloneAclone-5447761AT1G15820.1
TSS cloneAclone-5447760AT1G15820.1
TSS cloneAclone-5447759AT1G15820.1
TSS cloneAclone-5447757AT1G15820.1
TSS cloneAclone-5447755AT1G15820.1
TSS cloneAclone-5447753AT1G15820.1
TSS cloneAclone-5447751AT1G15820.1
TSS cloneAclone-5447749AT1G15820.1
TSS cloneAclone-5447747AT1G15820.1
TSS cloneAclone-5447745AT1G15820.1
TSS cloneAclone-5447742AT1G15820.1
TSS cloneAclone-5447741AT1G15820.1
TSS cloneCclone-5447740AT1G15820.1
TSS cloneAclone-5447735AT1G15820.1
TSS cloneAclone-5447734AT1G15820.1
TSS cloneCclone-5447730AT1G15820.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTCTTT-54477785447789AT1G15820.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTCCACGTGTCAT-54479955448007AT1G15820.1
 AtREG627TTCCACGT      PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382  CCACGTGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366   CACGTGTC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG389    ACGTGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG438     CGTGTCATABA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.