version
PlantPromoterDB promoter information of AT1G15880

Summary of Gene (AT1G15880)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G15880  TAIR      NCBI 
Gene model AT1G15880  
Description Golgi SNARE 11 protein (GOS11)  
#
#

Overview

Focused view (chromosome 1: 5461089-5459890)

Genome position     
from initiation codon
AT1G15880.1         
TSS from cDNA
TSS information
AT1G15880                        5'->3' (-)
Promoter sequence



 
AT1G15885.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G15880

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-5460381-292
TSS clone peakAclone-5460349-260
TSS cloneCclone-5460343-254
TSS cloneAclone-5460331-242

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCACGT-54604865460493-397-404
 AtREG547ATCCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCGATGTCGTTTA-54605115460522-422-433
 AtREG630CGATGTCG     PPDB Motif  PLACE Motif 
 AtREG569   TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565    GTCGTTTA PPDB Motif  PLACE Motif 
REGAACCCGGT-54605725460579-483-490
 AtREG516AACCCGGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+5460603AT1G15890.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCAT+54605795460586AT1G15890.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGGTTCGG+54603015460308AT1G15890.1
 AtREG655TGGTTCGG PPDB Motif  PLACE Motif 
REGACGTGGAT+54604865460493AT1G15890.1
 AtREG547ACGTGGATABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGTAAACGACATCG+54605115460522AT1G15890.1
 AtREG565TAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.