version
PlantPromoterDB promoter information of AT1G16810.1

Summary of Gene (AT1G16810.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G16810  TAIR      NCBI 
Gene model AT1G16810.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 5755150-5756349)

Genome position     
from initiation codon
AT1G16810.2         
TSS from cDNA
TSS information
AT1G16810.1                      5'->3' (+)
Promoter sequence











 
AT1G16800.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G16810.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+5755617-533
TSS clone peakTclone+5755632-518
TSS cloneTclone+5755638-512
TSS cloneTclone+5755642-508
TSS clone peakGclone+5756112-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCT+57556005755607-550-543
Y PatchTCCTCTCTCTT+57556295755639-521-511
Y PatchTCTTTCTC+57556425755649-508-501
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAAGCCC+57554595755466-691-684
 AtREG559CAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGATGTCGTTTT+57555165755527-634-623
 AtREG630CGATGTCG     PPDB Motif  PLACE Motif 
 AtREG569   TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520    GTCGTTTT PPDB Motif  PLACE Motif 
REGATATTGGGCCCTATTGGGCTTT+57555465755567-604-583
 AtREG509ATATTGGG               PPDB Motif  PLACE Motif 
 AtREG355 TATTGGGC  TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   TTGGGCCC            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG400    TGGGCCCT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG387     GGGCCCTA          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG624          CTATTGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG402            ATTGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407             TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376              TGGGCTTT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.