version
PlantPromoterDB promoter information of AT1G18060

Summary of Gene (AT1G18060)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G18060  TAIR      NCBI 
Gene model AT1G18060  
Description unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 16 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 6218664-6217465)

Genome position     
from initiation codon
AT1G18070.1         
AT1G18070.2         
TSS from cDNA
TSS information
AT1G18060                        5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G18060

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-6213350-36

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-6213355-41
TSS cloneAclone-6213352-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAACGACGA-62134166213425-102-111
 AtREG576GAAACGAC   PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG  PPDB Motif  PLACE Motif 
 AtREG648  AACGACGA PPDB Motif  PLACE Motif 
REGAAACCGAA-62136046213611-290-297
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-6218308AT1G18070.1, AT1G18070.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-6218319AT1G18070.1, AT1G18070.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTTCTTCTT-62182646218278AT1G18070.1, AT1G18070.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGACACGTGA-62184036218412AT1G18070.1, AT1G18070.2
 AtREG389TGACACGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366 GACACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG628  ACACGTGADREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGGACGTCGT-62184276218434AT1G18070.1, AT1G18070.2
 AtREG431GACGTCGT PPDB MotifACGT  PLACE MotifACGT 
REGGGCCTTAT-62184466218453AT1G18070.1, AT1G18070.2
 AtREG425GGCCTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTAAGGCCCATTAGTTGGGCTTT-62184606218482AT1G18070.1, AT1G18070.2
 AtREG577CTAAGGCC                PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC               PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357     GCCCATTA           PPDB MotifGCCCA  PLACE Motif 
 AtREG558      CCCATTAG          PPDB MotifGCCCA  PLACE Motif 
 AtREG607            AGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG574             GTTGGGCT   PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG407              TTGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376               TGGGCTTT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATATGGGCCTT-62185066218516AT1G18070.1, AT1G18070.2
 AtREG432ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.