version
PlantPromoterDB promoter information of AT1G18450.1

Summary of Gene (AT1G18450.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G18450  TAIR      NCBI 
Gene model AT1G18450.1  
Description Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes.  
#
#

Overview

Focused view (chromosome 1: 6347199-6348398)

Genome position     
from initiation codon
AT1G18440.1         
TSS from cDNA
TSS information
AT1G18450.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G18450.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+6348115-84

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+6348107-92
TSS cloneCclone+6348108-91
TSS cloneGclone+6348109-90
TSS cloneAclone+6348110-89
TSS cloneCclone+6348116-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTTCGGTTTAG+63479736347985-226-214
 AtREG655TGGTTCGG      PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT     PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568   TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514    TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511     CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTTCGGTTCGGTT+63479956348007-204-192
 AtREG556GTTCGGTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575  TCGGTTCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456   CGGTTCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    GGTTCGGT  PPDB Motif  PLACE Motif 
REGAACCCGAC+63480266348033-173-166
 AtREG580AACCCGAC PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.