version
PlantPromoterDB promoter information of AT1G18680.1

Summary of Gene (AT1G18680.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G18680  TAIR      NCBI 
Gene model AT1G18680.1  
Description HNH endonuclease domain-containing protein; FUNCTIONS IN: endonuclease activity, nucleic acid binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: HNH nuclease (InterPro:IPR003615), HNH endonuclease (InterPro:IPR002711); BEST Arabidopsis thaliana protein match is: HNH endonuclease domain-containing protein (TAIR:AT3G47490.1); Has 51 Blast hits to 51 proteins in 15 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 6434434-6433235)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G18680.1                      5'->3' (-)
Promoter sequence




 
AT1G18690.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G18680.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-6433440-6

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-6433445-11
TSS cloneGclone-6433442-8

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCC-64334176433425179
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGAACCG-64334966433503-62-69
 AtREG640TTGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCCGGTTCGGT-64335146433525-80-91
 AtREG455ACCCGGTT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CCGGTTCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456   CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    GGTTCGGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.