version
PlantPromoterDB promoter information of AT1G20620.4

Summary of Gene (AT1G20620.4)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G20620  TAIR      NCBI 
Gene model AT1G20620.4  
Description Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.  
#
#

Overview

Focused view (chromosome 1: 7142042-7143241)

Genome position     
from initiation codon
AT1G20620.1         
AT1G20620.2         
AT1G20620.5         
TSS from cDNA
TSS information
AT1G20620.4                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G20620.4

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+7143996-696
TSS peakT4+7144207-485
TSS peakA20+7144477-215

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+7144254-438
TSS cloneGclone+7144493-199

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCCT+71441607144167-532-525
Y PatchTTCTTCTT+71444657144472-227-220
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGGCTTTTT+71440787144088-614-604
 AtREG651TAGGGCTT    PPDB Motif  PLACE Motif 
 AtREG409  GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG589   GGCTTTTT PPDB Motif  PLACE Motif 
REGAAGCGCGT+71442187144225-474-467
 AtREG492AAGCGCGT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG38+7143118AT1G20620.2, AT1G20620.1, AT1G20620.5

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+7143067AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneCclone+7143075AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneCclone+7143082AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneTclone+7143083AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneCclone+7143084AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneAclone+7143085AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneCclone+7143086AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneTclone+7143087AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneAclone+7143088AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneAclone+7143089AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneCclone+7143091AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneAclone+7143093AT1G20620.2, AT1G20620.1, AT1G20620.5
TSS cloneGclone+7143115AT1G20620.2, AT1G20620.1, AT1G20620.5

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATGGCCCATTT+71429527142962AT1G20620.1, AT1G20620.2, AT1G20620.5
 AtREG437ATGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490 TGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361  GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG386   GCCCATTT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.