version
PlantPromoterDB promoter information of AT1G21600

Summary of Gene (AT1G21600)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G21600  TAIR      NCBI 
Gene model AT1G21600  
Description Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.  
#
#

Overview

Focused view (chromosome 1: 7574782-7573583)

Genome position     
from initiation codon
AT1G21600.1         
AT1G21600.2         
TSS from cDNA
TSS information
AT1G21600                        5'->3' (-)
Promoter sequence













 
AT1G21610.1         
AT1G21610.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G21600

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-7573802-20

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-7573846-64
TSS cloneAclone-7573812-30
TSS cloneTclone-7573801-19

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCCTTC-757375775737662516
Y PatchCGTCTTCC-75737717573778114
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGACG-75739387573945-156-163
 AtREG657AAATGACG PPDB Motif  PLACE Motif 
REGTTCGGGTCGGGTCGGGTCGG-75740787574097-296-315
 AtREG597TTCGGGTC             PPDB MotifGGGACCC  PLACE Motif 
 AtREG383 TCGGGTCGGGTCGGGTCG  PPDB Motif  PLACE Motif 
 AtREG375  CGGGTCGGGTCGGGTCGG PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442   GGGTCGGGTCGGG     PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405    GGTCGGGTCGGGT    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG390     GTCGGGTCGGGTC   PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone+7574000AT1G21610.1, AT1G21610.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTC+75739657573973AT1G21610.1, AT1G21610.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTAAAGGC+75736597573666AT1G21610.1, AT1G21610.2
 AtREG639TTAAAGGC PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGTCATTT+75739387573945AT1G21610.1, AT1G21610.2
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.