version
PlantPromoterDB promoter information of AT1G22040.1

Summary of Gene (AT1G22040.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G22040  TAIR      NCBI 
Gene model AT1G22040.1  
Description kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G55270.1); Has 8530 Blast hits to 4244 proteins in 221 species: Archae - 18; Bacteria - 386; Metazoa - 6931; Fungi - 33; Plants - 777; Viruses - 68; Other Eukaryotes - 317 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 7767370-7768569)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G22040.1                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G22040.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+7767988-382

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+7767924-446
TSS cloneAclone+7768029-341

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCCGGTTTAC+77678257767836-545-534
 AtREG463GACCCGGT     PPDB MotifAACCG(G/A), GGGACCC  PLACE Motif 
 AtREG455 ACCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412   CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519    CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGATCCAACGGTC+77678627767872-508-498
 AtREG586ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 AtREG554 TCCAACGG   PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG553   CAACGGTCAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.