version
PlantPromoterDB promoter information of AT1G26630

Summary of Gene (AT1G26630)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G26630  TAIR      NCBI 
Gene model AT1G26630  
Description Eukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection.  
#
#

Overview

Focused view (chromosome 1: 9204968-9206167)

Genome position     
from initiation codon
AT1G26630.1         
AT1G26630.2         
TSS from cDNA
TSS information
AT1G26630                        5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G26630

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA44+9205885-83

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+9205884-84
TSS cloneAclone+9205885-83
TSS cloneCclone+9205886-82
TSS cloneTclone+9205888-80
TSS cloneTclone+9205890-78
TSS cloneTclone+9205894-74
TSS cloneTclone+9205896-72
TSS cloneTclone+9205897-71
TSS cloneGclone+9205899-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATATAAAAA+92058509205863-118-105
Y PatchCCTTCCTCT+92058379205845-131-123
Y PatchCTTCTCTCTCTT+92058869205897-82-71
Y PatchTCTTCTCC+92059269205933-42-35
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTTGGGCTGGGCTGA+92057559205770-213-198
 AtREG474GTTTGGGC         PPDB MotifGCCCA  PLACE Motif 
 AtREG469 TTTGGGCT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG454     GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG609        TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGACCCTAGA+92058169205823-152-145
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.