version
PlantPromoterDB promoter information of AT1G27630

Summary of Gene (AT1G27630)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G27630  TAIR      NCBI 
Gene model AT1G27630  
Description CYCLIN T 1;3 (CYCT1;3); FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT5G45190.1); Has 1136 Blast hits to 1136 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 700; Fungi - 230; Plants - 139; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 9610647-9611846)

Genome position     
from initiation codon
AT1G27630.1         
TSS from cDNA
TSS information
AT1G27630                        5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G27630

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG15+9611108-539

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+9611103-544
TSS cloneCclone+9611115-532
TSS cloneGclone+9611122-525
TSS cloneTclone+9611124-523

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTATAAATA+96110719611080-576-567
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACAC+96109829610991-665-656
 AtREG520AAAACGAC   PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA  PPDB Motif  PLACE Motif 
 AtREG527  AACGACACDREB1Aox PPDB Motif  PLACE Motif 
REGGAAGCCCATAT+96110059611015-642-632
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477  AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGAAAGTCAAAGCCCATAT+96110509611066-597-581
 AtREG632AAAGTCAA          PPDB Motif  PLACE MotifTTGAC 
 AtREG559     CAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376      AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378       AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477        AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG432         GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.