version
PlantPromoterDB promoter information of AT1G27650.1

Summary of Gene (AT1G27650.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G27650  TAIR      NCBI 
Gene model AT1G27650.1  
Description U2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.  
#
#

Overview

Focused view (chromosome 1: 9614152-9615351)

Genome position     
from initiation codon
AT1G27630.1         
AT1G27650.2         
TSS from cDNA
TSS information
AT1G27650.1                      5'->3' (+)
Promoter sequence





 
AT1G27640.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G27650.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+9614575-577

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+9614551-601
TSS cloneGclone+9614582-570
TSS cloneTclone+9614583-569
TSS cloneTclone+9614587-565
TSS cloneTclone+9614589-563
TSS cloneGclone+9614590-562
TSS cloneAclone+9614603-549
TSS cloneCclone+9614609-543

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATAAATC+96145479614556-605-596
Y PatchTCTTTCTCC+96145919614599-561-553
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAACCGGTTCAA+96144139614425-739-727
 AtREG501TTAACCGG      PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503 TAACCGGT     PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG528   ACCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480    CCGGTTCA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640     CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAACCGGTC+96144549614464-698-688
 AtREG598ATAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552   AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGGAT+96144979614507-655-645
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.