version
PlantPromoterDB promoter information of AT1G28490.1

Summary of Gene (AT1G28490.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G28490  TAIR      NCBI 
Gene model AT1G28490.1  
Description Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.  
#
#

Overview

Focused view (chromosome 1: 10015433-10016632)

Genome position     
from initiation codon
AT1G28490.2         
TSS from cDNA
TSS information
AT1G28490.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G28490.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+10015918-515

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+10015919-514
TSS cloneGclone+10015937-496
TSS cloneCclone+10015978-455

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTATTGGGCTC+1001582910015840-604-593
 AtREG611CTTATTGG     PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG402   ATTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533    TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTTATTGGGCTTTAT+1001584910015863-584-570
 AtREG611CTTATTGG        PPDB Motif  PLACE Motif 
 AtREG417 TTATTGGG       PPDB MotifGCCCA  PLACE Motif 
 AtREG355  TATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402   ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407    TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376     TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365      GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601       GGCTTTAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.