version
PlantPromoterDB promoter information of AT1G29250.1

Summary of Gene (AT1G29250.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G29250  TAIR      NCBI 
Gene model AT1G29250.1  
Description nucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 10225592-10224393)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G29250.1                      5'->3' (-)
Promoter sequence











 
AT1G29260.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G29250.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-10224675-83

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-10224727-135
TSS cloneTclone-10224690-98
TSS cloneTclone-10224682-90
TSS cloneTclone-10224668-76

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTC-1022468510224692-93-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGATGTCGTTT-1022474110224751-149-159
 AtREG630CGATGTCG    PPDB Motif  PLACE Motif 
 AtREG569   TGTCGTTT PPDB Motif  PLACE Motif 
REGTAGCCCATTT-1022477010224779-178-187
 AtREG581TAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372 AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386  GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGCCCAATTGGGCCTATTGGGCT-1022478610224806-194-214
 AtREG647CCCAATTGGG            PPDB Motif  PLACE Motif 
 AtREG418   AATTGGGC           PPDB MotifGCCCA  PLACE Motif 
 AtREG352    ATTGGGCC          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356     TTGGGCCT         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358      TGGGCCTA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362       GGGCCTAT       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424        GGCCTATT      PPDB Motif  PLACE Motif 
 AtREG624           CTATTGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG355            TATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG402             ATTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+10224859AT1G29260.1
TSS cloneAclone+10224860AT1G29260.1
TSS clone peakGclone+10224874AT1G29260.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTT+1022487910224886AT1G29260.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAACGACATCG+1022474110224751AT1G29260.1
 AtREG569AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630   CGACATCG PPDB Motif  PLACE Motif 
REGAAATGGGCTA+1022477010224779AT1G29260.1
 AtREG386AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581  ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAGCCCAATAGGCCCAATTGGG+1022478610224806AT1G29260.1
 AtREG402AGCCCAAT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355 GCCCAATA             PPDB MotifGCCCA  PLACE Motif 
 AtREG624  CCCAATAG            PPDB MotifGCCCA  PLACE Motif 
 AtREG424     AATAGGCC         PPDB Motif  PLACE Motif 
 AtREG362      ATAGGCCC        PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358       TAGGCCCA       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356        AGGCCCAA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352         GGCCCAAT     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418          GCCCAATT    PPDB MotifGCCCA  PLACE Motif 
 AtREG647           CCCAATTGGG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.