version
PlantPromoterDB promoter information of AT1G29840.1

Summary of Gene (AT1G29840.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G29840  TAIR      NCBI 
Gene model AT1G29840.1  
Description esterase/lipase/thioesterase family protein; FUNCTIONS IN: catalytic activity; BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT3G47560.1); Has 2153 Blast hits to 2152 proteins in 431 species: Archae - 25; Bacteria - 868; Metazoa - 5; Fungi - 50; Plants - 119; Viruses - 2; Other Eukaryotes - 1084 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 10448422-10447223)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G29840.1                      5'->3' (-)
Promoter sequence

 
AT1G29850.1         
AT1G29850.2         
AT1G29850.3         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G29840.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-10447435-13

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCGCTT-1044772810447735-306-313
 AtREG492ACGCGCTT PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+10447754AT1G29850.1, AT1G29850.2, AT1G29850.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+10447755AT1G29850.1, AT1G29850.2, AT1G29850.3
TSS cloneTclone+10447768AT1G29850.1, AT1G29850.2, AT1G29850.3
TSS cloneCclone+10447774AT1G29850.1, AT1G29850.2, AT1G29850.3
TSS cloneTclone+10447777AT1G29850.1, AT1G29850.2, AT1G29850.3
TSS cloneAclone+10447779AT1G29850.1, AT1G29850.2, AT1G29850.3
TSS cloneTclone+10447793AT1G29850.1, AT1G29850.2, AT1G29850.3
TSS cloneAclone+10447809AT1G29850.1, AT1G29850.2, AT1G29850.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTTAATGGG+1044746210447470AT1G29850.1, AT1G29850.2, AT1G29850.3
 AtREG604CTTAATGG  PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG PPDB MotifGCCCA  PLACE MotifTTAATGG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.