version
PlantPromoterDB promoter information of AT1G30510.2

Summary of Gene (AT1G30510.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G30510  TAIR      NCBI 
Gene model AT1G30510.2  
Description Encodes a root-type ferredoxin:NADP(H) oxidoreductase.  
#
#

Overview

Focused view (chromosome 1: 10809984-10808785)

Genome position     
from initiation codon
AT1G30510.1         
AT1G30510.3         
AT1G30515.1         
TSS from cDNA
TSS information
AT1G30510.2                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G30510.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-10809114-130

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-10809163-179
TSS cloneGclone-10809150-166
TSS cloneAclone-10809143-159
TSS cloneGclone-10809114-130
TSS cloneTclone-10809049-65
TSS cloneTclone-10809047-63
TSS cloneAclone-10809045-61
TSS cloneTclone-10809041-57

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGTTCGGTT-1080923310809243-249-259
 AtREG575TCGGTTCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT  PPDB Motif  PLACE Motif 
 AtREG556   GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGGTTCGGTTTGG-1080925910809271-275-287
 AtREG655TGGTTCGG      PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT     PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568   TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550     CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTTCGGTT-1080929010809297-306-313
 AtREG556GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.