version
PlantPromoterDB promoter information of AT1G31360.1

Summary of Gene (AT1G31360.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G31360  TAIR      NCBI 
Gene model AT1G31360.1  
Description Encodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro.  
#
#

Overview

Focused view (chromosome 1: 11231422-11232621)

Genome position     
from initiation codon
AT1G31360.2         
TSS from cDNA
TSS information
AT1G31360.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G31360.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+11232363-59

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCATTTA+1123227911232291-143-131
 AtREG409AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386    GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443     CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGTTAAGGCCCAATAT+1123230811232321-114-101
 AtREG416TTAAGGCC       PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509      CCCAATAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.