version
PlantPromoterDB promoter information of AT1G31730.1

Summary of Gene (AT1G31730.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G31730  TAIR      NCBI 
Gene model AT1G31730.1  
Description epsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 11358907-11360106)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G31730.1                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G31730.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+11359644-263
TSS peakA2+11359853-54

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+11359642-265

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTCTCCTTC+1135964611359660-261-247
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGAA+1135940511359412-502-495
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGAACCA+1135943411359443-473-464
 AtREG556AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655  CCGAACCA PPDB Motif  PLACE Motif 
REGCCAAACCGAA+1135946511359474-442-433
 AtREG550CCAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGGATTCCGGTTAAA+1135950811359527-399-380
 AtREG542AAAACCGG             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561  AACCGGAT           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534         TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621          TCCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501           CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG645            CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGACACGCGTGT+1135954911359558-358-349
 AtREG536ACACGCGTGTABA, Drought PPDB Motif  PLACE MotifACACNNG 
REGCTATTGGG+1135957311359580-334-327
 AtREG624CTATTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.