version
PlantPromoterDB promoter information of AT1G34370.3

Summary of Gene (AT1G34370.3)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G34370  TAIR      NCBI 
Gene model AT1G34370.3  
Description Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity.  
#
#

Overview

Focused view (chromosome 1: 12550449-12551648)

Genome position     
from initiation codon
AT1G34370.1         
AT1G34370.2         
TSS from cDNA
TSS information
AT1G34370.3                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G34370.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+12551040-409
TSS peakG4+12551420-29

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+12550477-972
TSS cloneTclone+12550485-964
TSS cloneCclone+12550487-962
TSS cloneTclone+12550496-953
TSS cloneTclone+12550498-951
TSS cloneTclone+12550501-948
TSS cloneTclone+12550526-923
TSS cloneAclone+12550571-878
TSS cloneAclone+12550572-877
TSS cloneAclone+12550994-455
TSS cloneAclone+12551198-251

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCCTCTCTCTCT+1255048112550496-968-953
Y PatchCTTTCTCT+1255051312550520-936-929
Y PatchCTCTTCTTC+1255104312551051-406-398
Y PatchTCTTCTTCC+1255142412551432-25-17
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAACCGT+1255019912550207-1250-1242
 AtREG598ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652 TAAACCGT PPDB Motif  PLACE Motif 
REGACCGTCAGA+1255034712550355-1102-1094
 AtREG625ACCGTCAG  PPDB Motif  PLACE Motif 
 AtREG622 CCGTCAGA PPDB Motif  PLACE Motif 
REGTTAATGGGTTGACTTT+1255039712550412-1052-1037
 AtREG396TTAATGGG         PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG632        TTGACTTT PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.