version
PlantPromoterDB promoter information of AT1G36990.1

Summary of Gene (AT1G36990.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G36990  TAIR      NCBI 
Gene model AT1G36990.1  
Description unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08510.1); Has 4597 Blast hits to 1552 proteins in 255 species: Archae - 0; Bacteria - 986; Metazoa - 1160; Fungi - 777; Plants - 63; Viruses - 27; Other Eukaryotes - 1584 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 14030711-14029512)

Genome position     
from initiation codon
AT1G36992.1         
TSS from cDNA
TSS information
AT1G36990.1                      5'->3' (-)
Promoter sequence







 
AT1G36992           
AT1G36992.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G36990.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-14030492-781

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-14030500-789
TSS cloneTclone-14030499-788
TSS cloneGclone-14030463-752

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTTGGGCCTATA-1403061114030623-900-912
 AtREG607AGTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG449 GTTGGGCC     PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362    GGGCCTAT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG487     GGCCTATA PPDB Motif  PLACE Motif 
REGTTATGGGCCCATCT-1403063314030646-922-935
 AtREG394TTATGGGC       PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391  ATGGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG403     GGCCCATC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG572      GCCCATCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.