version
PlantPromoterDB promoter information of AT1G44446

Summary of Gene (AT1G44446)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G44446  TAIR      NCBI 
Gene model AT1G44446  
Description Encodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.  
#
#

Overview

Focused view (chromosome 1: 16852152-16850953)

Genome position     
from initiation codon
AT1G44446.1         
AT1G44446.2         
AT1G44446.3         
TSS from cDNA
TSS information
AT1G44446                        5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G44446

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4-16851189-37

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-16851224-72
TSS cloneAclone-16851195-43
TSS cloneGclone-16851189-37
TSS cloneTclone-16851188-36
TSS cloneAclone-16851182-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTTTC-1685116316851171-11-19
Y PatchCTTTCTTCT-1685119716851205-45-53
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACACGTGTCAT-1685129416851305-142-153
 AtREG453TACACGTG    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG366  CACGTGTC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG389   ACGTGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG438    CGTGTCATABA PPDB Motif  PLACE Motif 
REGCCGCCACGTGTT-1685131616851327-164-175
 AtREG560CCGCCACG    ABA PPDB MotifCCGAC  PLACE MotifGCCAC 
 AtREG371 CGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG382   CCACGTGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG590    CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.