version
PlantPromoterDB promoter information of AT1G50450.1

Summary of Gene (AT1G50450.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G50450  TAIR      NCBI 
Gene model AT1G50450.1  
Description binding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saccharopine dehydrogenase (InterPro:IPR005097), NAD(P)-binding (InterPro:IPR016040); Has 934 Blast hits to 931 proteins in 259 species: Archae - 13; Bacteria - 434; Metazoa - 33; Fungi - 62; Plants - 25; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 18691348-18690149)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G50450.1                      5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G50450.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA15-18690359-11

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-18690365-17
TSS cloneAclone-18690364-16
TSS cloneGclone-18690363-15
TSS cloneGclone-18690362-14
TSS cloneGclone-18690361-13
TSS cloneAclone-18690359-11
TSS cloneGclone-18690358-10
TSS cloneGclone-18690357-9

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACACGTCATC-1869040518690414-57-66
 AtREG517ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG483 CACGTCAT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG578  ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGATAAAGCCCAACT-1869043718690449-89-101
 AtREG601ATAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574    AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG607     GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGATTAGGCCCAGA-1869045118690462-103-114
 AtREG506ATTAGGCC     PPDB Motif  PLACE Motif 
 AtREG360 TTAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410   AGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397    GGCCCAGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATAAGGCCCAGA-1869047218690483-124-135
 AtREG425ATAAGGCC     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351 TAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410   AGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397    GGCCCAGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGACGGGCCTTAT-1869051418690524-166-176
 AtREG429ACGGGCCT    PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG351  GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425   GGCCTTAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.