version
PlantPromoterDB promoter information of AT1G51980.2

Summary of Gene (AT1G51980.2)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G51980  TAIR      NCBI 
Gene model AT1G51980.2  
Description mitochondrial processing peptidase alpha subunit, putative; FUNCTIONS IN: metalloendopeptidase activity, ATP binding; INVOLVED IN: proteolysis, response to salt stress; LOCATED IN: in 6 components; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: MPPalpha (mitochondrial processing peptidase alpha subunit); catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding (TAIR:AT3G16480.1); Has 4104 Blast hits to 4031 proteins in 871 species: Archae - 10; Bacteria - 1938; Metazoa - 533; Fungi - 396; Plants - 134; Viruses - 3; Other Eukaryotes - 1090 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 1: 19330621-19329422)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G51980.2                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G51980.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5-19326871-100

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-19326882-111
TSS cloneAclone-19326870-99
TSS cloneGclone-19326857-86
TSS cloneTclone-19326856-85
TSS cloneTclone-19326848-77
TSS cloneCclone-19326847-76
TSS cloneCclone-19326845-74
TSS cloneAclone-19326839-68
TSS cloneTclone-19326838-67
TSS cloneGclone-19326831-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCCTCTCTCTCT-1932684019326856-69-85
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTATGGGCCTAT-1932694519326956-174-185
 AtREG394TTATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362    GGGCCTAT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGATATTGGG-1932697419326981-203-210
 AtREG509ATATTGGG PPDB Motif  PLACE Motif 
REGATTGGGCCAAGCCCATAA-1932698619327003-215-232
 AtREG352ATTGGGCC           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TTGGGCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484  TGGGCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG525       CAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378        AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477         AGCCCATA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394          GCCCATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.