version
PlantPromoterDB promoter information of AT1G56070

Summary of Gene (AT1G56070)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G56070  TAIR      NCBI 
Gene model AT1G56070  
Description encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive.  
#
#

Overview

Focused view (chromosome 1: 20972077-20970878)

Genome position     
from initiation codon
AT1G56070.1         
TSS from cDNA
TSS information
AT1G56070                        5'->3' (-)
Promoter sequence















 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G56070

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG366-20971706-629

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-20971742-665
TSS cloneTclone-20971711-634
TSS cloneCclone-20971709-632
TSS cloneTclone-20971708-631
TSS cloneGclone-20971706-629
TSS cloneCclone-20971705-628
TSS cloneAclone-20971704-627
TSS cloneTclone-20971699-622

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTATATAAT-2097173820971747-661-670
Y PatchTCTTTCTCTCT-2097166920971679-592-602
Y PatchTCTTTCTCTC-2097168720971696-610-619
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTGGCCCATTAAGGCCCATTAAG-2097180420971827-727-750
 AtREG446ATTGGCCC                CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG484 TTGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  TGGCCCAT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT  GGCCCATT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA  GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA  CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604      CCATTAAG  CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
 AtREG416         TTAAGGCC        PPDB Motif  PLACE Motif 
 AtREG351          TAAGGCCC       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353           AAGGCCCA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354            AGGCCCAT     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATTGGCCC-2097183520971842-758-765
 AtREG446ATTGGCCCCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTGGGCTCA-2097188720971894-810-817
 AtREG485TGGGCTCA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTCGGTTTAC-2097198020971988-903-911
 AtREG514TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519 CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.