version
PlantPromoterDB promoter information of AT1G56280.1

Summary of Gene (AT1G56280.1)

Organism Arabidopsis thaliana  
Chromosome 1  
Locus AT1G56280  TAIR      NCBI 
Gene model AT1G56280.1  
Description Encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal  
#
#

Overview

Focused view (chromosome 1: 21075725-21074526)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT1G56280.1                      5'->3' (-)
Promoter sequence














 
AT1G56290.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT1G56280.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA44-21074839-114
TSS peakC30-21074730-5

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-21074863-138
TSS cloneCclone-21074852-127
TSS cloneCclone-21074851-126
TSS cloneTclone-21074850-125
TSS cloneTclone-21074848-123
TSS cloneTclone-21074840-115
TSS cloneCclone-21074838-113

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTCTTC-2107481421074826-89-101
Y PatchCTTTCTCTTCCTCTCTCCTCCT-2107484021074861-115-136
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAACCGGTC-2107490621074914-181-189
 AtREG528GAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552 AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAACCGG-2107493021074937-205-212
 AtREG496CAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAACCGGAA-2107494621074955-221-230
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534  AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAACCGGTC-2107500021075009-275-284
 AtREG501TTAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503 TAACCGGT  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG552  AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGTC-2107506621075074-341-349
 AtREG528GAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552 AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACGAC-2107509321075100-368-375
 AtREG520AAAACGAC PPDB Motif  PLACE Motif 
REGATAAACCGGAA-2107510521075115-380-390
 AtREG598ATAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13+21075293AT1G56290.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+21075286AT1G56290.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTTCTTCC+2107530921075319AT1G56290.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACCGGTTAA+2107500021075009AT1G56290.1
 AtREG552GACCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503 ACCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501  CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGGACCGGTTC+2107506621075074AT1G56290.1
 AtREG552GACCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528 ACCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCGTTTT+2107509321075100AT1G56290.1
 AtREG520GTCGTTTT PPDB Motif  PLACE Motif 
REGTTCCGGTTTAT+2107510521075115AT1G56290.1
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598   CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGACCGGTTAT+2107516621075175AT1G56290.1
 AtREG552GACCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503 ACCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG548  CCGGTTAT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGCCGGTTTT+2107518921075196AT1G56290.1
 AtREG542CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTTTAT+2107520821075218AT1G56290.1
 AtREG573GTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598   CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.